Serie de ejercicios VI biomoléculas




descargar 31.64 Kb.
títuloSerie de ejercicios VI biomoléculas
fecha de publicación14.08.2016
tamaño31.64 Kb.
tipoDocumentos
med.se-todo.com > Derecho > Documentos
FQB 122 QUIMICA ORGANICA

SERIE DE EJERCICIOS VI Biomoléculas

SEMESTRE II/2014

  1. Convertir las siguientes estructuras de Fischer a estructuras tetraédricas. Asignar la configuración S o R







  1. Dibujar las estructuras de los productos que se espera obtener por reacción de β-D-talopiranosa con a) NaBH4 b) CH3CH2OH en medio ácido (formación de glucósido) c) CH3I , Ag2O, anhídrido acético en solvente piridina



  1. Dar las estructuras de los siguientes disacáridos (usar proyección de Haworth):

4-O-(β-D-ribosil)-α-D-galactopiranosa

2-O-(α-D-glucosil)-β-D-fructofuranosa

  1. Dar la estructuras de los productos que se espera obtener en las siguientes reacciones



  1. Lactosa + NaBH4 b) sacarosa+ NaBH4 c) Lactosa + CH3OH (medio ácido)

d) sacarosa +CH3OH

e) lactosa+CH3I con Ag 2O como catalizador, seguido de hidrólisis

f) sacarosa+CH3I con Ag 2O como catalizador, seguido de hidrólisis

  1. La gentiobiosa es un monosacárido que se encuentra en el azafrán , es un azúcar reductor que da lugar a la formación de D-glucosa cuando se hidroliza en presencia de ácido. Cuando la gentiobiosa reacciona con iodometano y óxido de plata, se obtiene un derivado octametilado que puede ser hidrolizado para dar lugar a un equivalente de 2,3,4,6-tetra-o-D-glucopiranosa y un equivalente de 2,3,4-tri-o-metil-D-glucopiranosa. Esquematizar la estructura del disacárido, conociendo que el enlace glucosídico es β.

  2. La trehalosa es un disacárido no reductor que es hidrolizado por ácido acuoso dando lugar a dos equivalentes de glucosa. La metilación exhaustiva seguida de hidrólisis da lugar a dos equivalentes de 2,3,4,6-tetra-O-metilglucosa. ¿Cuántas estructuras son posibles para trehalosa?

  3. Se han aislado 50mg de una glicoproteína y se busca determinar la cantidad de glúcido que contiene esta biomolécula. Para cumplir con esta finalidad, se disuelven los 50 mg de proteína en 20 mL de una solución que permite hidrolizar el enlace entre la proteína y la cadena polisacárida. Se agrega entonces ácido tricloroacético para hacer precipitar las cadenas polipeptídicas, se somete la mezcla a centrifugación y se determina la concentración de glúcidos en el sobrenadante. Para ello se mezcla 1 mL de sobrenadante con 1 mL de fenol en ácido sulfúrico concentrado. Este tratamiento da lugar al desarrollo de color y se mide la absorbancia de la mezcla. El mismo tratamiento se aplica a soluciones patrón de glucosa de concentración conocida. Los resultados obtenidos se pueden observar en la tabla 1.

Tabla 1 Valores de absorbancia obtenidos para las soluciones patrón y la muestra

Conc(mg/mL)

0,5

1,0

1,5

2,0

2,5

x

Abs

0,101

0,198

0,301

0,405

0,503

0,150

  1. Graficar los valores de absorbancia en función a la concentración para las soluciones patrón. Determinar de forma gráfica la concentración en glúcidos de la muestra

  2. Utilizar un método de regresión lineal para determinar la concentración de la muestra.

  3. ¿Qué porcentaje de glúcidos (peso/peso) contiene la glucoproteína aislada?

http://t0.gstatic.com/images?q=tbn:and9gctbrpiznxyojbjlexskmtyel4kzvyuuznd_qb67r_pqbkxkyula



  1. a) Dibujar las estructuras que se obtendrán si se somete la rafinosa, de forma consecutiva, a los siguientes tratamientos:

  • Reducción con borohidruro de sodio (NaBH4, la reducción se da únicamente en los carbonos anoméricos libres)

  • Metilación (el hidrogeno de los grupos OH libres es reemplazado por metilo)

  • Hidrólisis y nueva reducción

  • Acetilación (formación de uniones ester por reacción entre los grupos hidroxilo libres y cloruro de acetilo)

  1. Un trisacárido es sometido a los pasos mencionados en el inciso a). Como resultado de este tratamiento se obtienen los productos siguientes. Dar la estructura del trisacárido inicial.

CH3OCH

H COCH3

HCO C CH3

C H3 OCH

H2COCH3

H2CO C CH3

O

O

H COCH3

H COCH3

H CO-CH3

H COCCH3

H2COCH3

H2COCH3

O

H COCH3

H COCCH3

C H3 OCH

H2CO C CH3

H2CO C CH3

O

O

O

  1. Esquematizar las siguientes estructuras :

  1. amilosa (polisacárido formado de residuos de glucosa unidos por uniones α-(1->4)

  2. amilopectina (polisacárido formado de residuos de glucosa unidos por uniones α-(1->4) y α (1->6)

  3. un polisacárido formado por unidades alternantes de galactosa y fructosa. Los carbonos anoméricos de las unidades de galactosa forman enlaces β (1->3) mientras los carbonos anoméricos de las unidades de fructosa forman enlaces β (2->4) .

  1. Indicar los productos de hidrólisis que se espera obtener al tratar los siguientes lípidos con una solución de NaOH en caliente (suponer que se hidrolizan los enlaces ester, los enlaces fosfoester y los enlaces glucosídicos):



  1. Dioleil-laurilglicérido b) palmitoilgalactocerebrósido c) fosfatidilcolina

11)a) Dibujar los productos que se obtendrán al agregar KOH a cada una de las moléculas esquematizadas en el inciso i)

  1. Indicar (justificando) si ii) o iii) tiene mayor punto de fusión

CH

H C

CH3

(CH2)12

O = C

H2C- CH - CH

OH

OH

NH

(CH2)16

CH3

i)


H2COC(CH2)14 CH3

O
O

iii)

CH3(CH2)6 C OCH

H COCCH2CH=CH-(CH2)3 CH3

O

O

H COCCH2CH=CH-(CH2)5 CH3


ii)



CH3(CH2)12 C OCH



O

O



H COCCH2CH=CH-(CH2)11 CH3


12)a) Esquematizar los lípidos miristil-lauril fosfatidil serina y palmitoilserinesfingomielina

  1. Esquematizar una bicapa formada por estos lípidos



  1. a) El índice de saponificación de un lípido corresponde a la masa de NaOH (en gramos) requerida para hidrolizar 100 g de un lípido. Calcular el índice de saponificación para tripalmitoilglicérido y para tricaproilglicérido. Indicar la relación entre tamaño de cadena e los ácidos grasos que constituyen un lípido y el índice de saponificación

  1. El I2 reacciona con los dobles enlaces presentes en los ácidos grasos mediante una reacción de adición electrofílica. El índice de iodo se define por tanto como los mg de I2 que reaccionan con 1 g de lípido, a mayor número de insaturaciones, mayor índice de yodo. Calcular este índice para trioleilglicérido y trilinoleilglicérido.



  1. Se ha aislado un fragmento de ARN cuya secuencia es AUGGAUAUAGAGUGAGAUAUCCGGp

  1. Esquematizar la estructura del extremo 5’ (tres nucleótidos)

  2. Esquematizar la estructura del extremo 3’ (tres nucleótidos)

  3. Indicar si esta secuencia podría tender a formar algún tipo de estructura secundaria. En caso de respuesta positiva, esquematizar esta estructura secundaria



  1. Se tienen las siguientes dos hebras de ADN monocatenarias:

  1. ATGCGGTCCGC T y ii) GTTATGAATCAT

  1. Escribir la secuencia de las hebras complementarias

  2. Conociendo que la temperatura de fusión de las dobles hebras está dada por T=69,3+0,41(%G+%C), calcular la temperatura de fusión para las dobles hebras obtenidas en a)

  3. Esquematizar la curva que se espera obtener si se grafica el porcentaje de aumento de absorbancia a 260nm en función a la temperatura para las dos dobles hebras

  4. Escribir la secuencia que se espera obtener en el RNA mensajero transcrito partir de las hebras monocatenarias i) y ii)

  5. Dar la secuencia de aminoácidos codificados por los dos fragmentos de RNA mensajero.

16) a) Dar los diferentes estados ionización de los aminoácidos Ile y Lys en función al pH

b) Dibujar las curvas de titulación para ambos aminoácidos

c) Esquematizar las curvas de abundancia relativa de los distintos estados de ionización en función al pH

d) Se pueden analizar mezclas de aminoácidos y péptidos mediante cromatografía sobre papel (ver Fig. 1). La mezcla se coloca en el centro del papel y los diferentes componentes migran hacia los polos en función a su carga y a su peso molecular. Para poder visualizar la ubicación de los péptidos se utiliza comúnmente el colorante ninhidrina, que reacciona con aminoácidos. ¿Hacia qué polo se espera que migren los dos aminoácidos si se trabaja a pH 7?

Dos placas de vidrio

Fuente de poder

Electrolito

Papel filtro

muestra

Figura 1. Equipo para la electroforesis sobre papel (Tomado de http://www.funsci.com/fun3_en/exper1/exper1_21.gif)

17) Esquematizar el tripéptido : Ala-Glu-Leu

b) Esquematizar los distintos estados de ionización que puede tener este tripéptido.

c) Hacer un esquema de la curva de titulación
18) Para el aminoácido glicocola tenemos, por balance de materia, que la concentración total del aminoácido c está dada por :

C=[GlyH2+]+[GlyH]+[Gly-]

Por ecuación de Hendersson y Hasselbalch tenemos además:

pH=pK1+ log([GlyH]/[GlyH2+]) y pH=pK2+log([Gly-]/[GlyH])

a) Dibujar las moléculas representadas por las abreviaciones GlyH2, GlyH, y Gly-

b) Se tiene una solución de concentración total en glicocola 1 M, determinar, la concentración en GlyH2 a pH 1 y a pH 1.9. Para estos valores de pH, considerar que la concentración de Gly- es despreciable.

c) Determinar la concentración del zwitterion a en el punto isoeléctrico

19) Se tienen los péptidos Ala-Lys-Cys-Pro y Val-Ile-Gly-Cys

a) Esquematizar la estructura de estos péptidos

b) Indicar (Justificando) si estos péptidos se separarán a pH 1, a pH 7 o a pH 11.

similar:

Serie de ejercicios VI biomoléculas iconEs la serie de ejercicios o actividades que realizamos después del calentamiento general para

Serie de ejercicios VI biomoléculas iconResumen se presentan una serie de ejercicios para estudiar cuestiones...

Serie de ejercicios VI biomoléculas iconBiomoléculas

Serie de ejercicios VI biomoléculas iconBioelementos y biomoléculas

Serie de ejercicios VI biomoléculas icon1. biomoléculas orgánicas

Serie de ejercicios VI biomoléculas iconIntroducción a la bioquímica y biomoléculas

Serie de ejercicios VI biomoléculas iconMÓdulo II. Biomoléculas agua

Serie de ejercicios VI biomoléculas iconIntroducción a la bioquímica y biomoléculas

Serie de ejercicios VI biomoléculas iconTaller biomoléculas y alimentos

Serie de ejercicios VI biomoléculas iconTem biolementos y biomoléculas


Medicina



Todos los derechos reservados. Copyright © 2015
contactos
med.se-todo.com